The 2015 AKC Canine Health Foundation Conference

By Laura Liscum on behalf of the PBGVCA Health Committee

In August, the AKC Canine Health Foundation (CHF) sponsored the 2015 National Parent Club Canine Health Conference in St. Louis. Linda Murray and I attended the conference on behalf of the PBGVCA and the PBGV Health & Rescue Foundation, respectively. We both thought that it was a fabulous experience with excellent talks, abundant opportunities to interact with the speakers, and lots of free dog chow! Here is a synopsis of several presentations that we heard at the conference.

Stem Cells Therapy for Supraspinatus Tendonopathy.
Dogs injure ligaments and tendons while chasing bunnies in the field, running agility courses and roughhousing at doggie daycare. Like their owners, many dogs develop osteoarthritis after years of activity. The traditional surgical repair, medications and rehabilitation therapy have not always restored the injured dog to his/her pre-injury state. Two years ago, we heard Dr. Sherman Canapp describe his remarkable results when traditional treatment approaches are combined with stem cells or platelet-rich plasma therapy. His work continues to look very promising.

This year we heard Dr. Jennifer Barrett from Virginia-Maryland Regional College of Veterinary Medicine. Barrett described her collaborative studies with Canapp using stem cells and platelet-rich plasma to heal 57 agility dogs with shoulder injuries that had been lame for more than a yeardespite treatment with non-steroidal anti-inflammatory drugs, steroids and sessions in rehab. Dogs were treated with stem cells, which are undifferentiated cells that are able to divide and develop into specialized cells that repair and replenish adult tissues. They also treated the dogs with platelet-rich plasma isolated from the canine patient’s blood. Platelets are a natural source of bioactive proteins and growth factors that stimulate collagen formation and healing of tendons and ligaments. In fact, platelet rich plasma is currently being used to treat human and equine athletes. The dogs received pre-treatment analysis of gait and limb movement. Then stem cells and platelets were isolated and injected into the soft tissue lesions, guided by ultrasound.

The dog returned each month for ultrasound gait and limb movement analyses. The site of injury was examined by arthroscopy at 90 days. The outcomes of this study were very encouraging! The AKC CHF is now funding Drs. Barrett and Canapp to conduct the first randomized, placebocontrolled clinical trial of stem cells and platelet-rich plasma for supraspinatus tendon injury. They are having a difficult time enrolling enough dogs for the trial, so if you have an injured dog, please inquire.Puppies

Regenerative Medicine
Techniques to Treat Cartilage Disorders. Complaints about aching joints are not limited to the athletic canine. Couch potatoes can get injured too. In fact, 80 percent of all dogs have orthopedic joint disease at some point. One type of joint disease is called osteochondrosis, in which the joint’s cartilage becomes damaged. If a weakened flap of tissue breaks off, the piece may absorb minerals and harden. Imagine what it would feel like to have a pebble floating around in your joint! Unfortunately, joints do not regenerate healthy tissue very well. Dr. William Saunders, from Texas A&M, described a method for healing degenerated joints in which a plug of tissue is taken out of a non-weight-bearing portion of a dog’s healthy joint and grafted into the same dog’s damaged joint. This autograft can successfully restore function to the formerly damaged joint. However, this is like robbing Peter to pay Paul — the donor site now has a weakened cavity. Dr. Saunders’s goal is to develop a method to strengthen the donor site. His approach is to create replacement plugs made of porous polyethylene glycol and seeded with healthy bone-derived stem cells. In his preliminary studies, he placed these artificial plugs into the donor sites, and the stem cells within the plug populated the joint. This is an important step in bringing the autograft therapy method to the clinic.

Personalized Cancer Treatment.
Most treatment strategies for cancer use a standard approach in which all individuals with a particular cancer are treated with the same standard drug therapy. Unfortunately, this approach fails to take into account the molecular differences between individual cancers. Precision medicine is a new approach in which treatments are selected only after an individual’s tumor has been profiled to find specific gene mutations that led to their cancer.

Dr. Douglas Thamm of Colorado State University is investigating Toceranib, a therapeutic for mast-cell tumors that is used when surgery is not curative. Toceranib, marketed as Palladia, is the only dog-specific anti-cancer drug that is currently approved by the U.S. Food and Drug Administration. It acts by binding to a specific protein in tumor cells. Dr. Thamm hypothesizes that treatment with Toceranib will only be successful on dogs whose tumors are due to mutation of that specific protein. To test this hypothesis, Dr. Thamm has developed a rapid test that can be performed on fine-needle aspirates. The test can rapidly determine whether a dog’s mast-cell tumor has the mutation so that a therapeutic decision can be made within days. This test is the first step toward personalized medicine in the treatment of canine mast-cell tumors.

Atopic Dermatitis and the Mycobiome.
“You’ll Never Walk Alone” is a Rodgers and Hammerstein song from the musical Carousel. When he wrote the lyrics in 1945, Hammerstein had no way of knowing that when you walk through a storm, at least 100 trillion bacteria walk with you. In fact, 90 percent of our body’s cells are bacteria! We truly never walk alone. Fortunately, the microbes that colonize us are non-pathogenic symbiotic bacteria and fungi that are critical for our health. The abundance of these friendly microbes keeps the pathogenic organisms at bay.

Dr. Jan Suchodolski from Texas A&M is studying the canine mycobiome, which is the dog’s fungal community. He has determined that “the skin of dogs is inhabited by much more rich and diverse microbial communities than previously thought.” His recent publication [Hoffman, 2014] showed that each dog has a unique community of microorganisms, and each area of a dog’s skin harbors a unique selection of microbes. Healthy dogs have from 25 to 40 different species in their nostrils and up to 866 species in an ear! The composition of the microbial community did not appear to be influenced by dog age, sex, breed, itchiness, ear problems or indoor/outdoor environment. However, there was a significant difference when healthy dogs were compared to those with atopic dermatitis, or allergies. Dogs with allergies had fewer species of microbes than healthy dogs. Future work is needed to determine whether the reduced diversity of the skin mycobiome in allergic dogs isthe cause of, or the result of, the animal’s hypersensitivity to allergens. It is not known if the skin mycobiome shifts during allergic episodes. Finally, the possibility exists that restoring the microbe community to healthy levels will help treat atopic dermatitis.

Senior Cognition and Brain Aging.
Are you slower to get out of bed in the morning? Can’t remember who that person in front of you is? Finding it harder to negotiate a familiar environment? Have a decreased attention span and a loss of knowledge? Feeling anxious about all of these changes? These are questions that you should be asking your senior dog. From about six years of age on, your dog will begin to exhibit signs of brain aging that are so subtle that you may not notice them. Signs that are severe enough for you to notice include new fears or phobias, separation anxiety, soiling in the house, waking at night, vocalization and repetitive actions. Many owners do not report the first signs of aging to their vet because they think that nothing can be done. But there is evidence that early intervention may help.

Dr. Gary Landsberg from the North Toronto Veterinary Behaviour Specialty Clinic has extensive experience in testing cognition in senior dogs. Senior dogs get Alzheimer’s-like brain changes and have measurable deficits in learning and memory. When cognitive dysfunction is suspected, a vet must first rule out medical issues, and conduct neurological and sensory physical exams. Dr. Landsberg is also director of Veterinary Affairs at CanCog, a contract organization that specializes in non-invasive research on canine cognition and general behavior. His videos of the CanCog Beagle colony illustrated a typical cognitive test. First, let a dog learn a task such as quickly finding the food treat that is under the large box, but never under the small box. Once the task is learned, you present the dog with a reversal task by putting the treat under the small box. Young dogs quickly learn that the task has been reversed, whereas older dogs take significantly longer. But it turns out you can teach an old dog this new trick if you have provided the dog with an enriched environment. Dr. Landsberg said that you should make a senior dog work his/her brain everyday! He cited several pharmaceuticals that he prescribes for dogs that are showing cognitive dysfunction. He said that senior dogs show improvement with the medications individually and do even better when they are in combination. He encouraged owners to ask their vets for help. He also recommended two foods for dogs older than six; they are Hills b/d Canine and Purina Bright Minds (discussed below). Both have additives that help senior dogs maintain learning and memory skills.

Bright Mind Platform.
The brain is the most metabolically active organ in the body. At rest, the human brain uses up to 25 percent of the body’s energy even though it only accounts for 2 percent of the body’s mass. When challenged by a Sudoku puzzle, the energy needs go up. That energy is obtained from glucose that enters brain tissue from the blood. The situation is similar in dogs. Dr. Gary Penn, from the Nestlé Research Center, explained that dogs begin to show behavior signs of aging because their brains lose the ability to metabolize glucose around the age of 7. Investigators at the Nestlé Research Center explored alternative energy sources and found that adding medium chain triglycerides to the food increased the ability of dogs at the CanCog facility to perform cognitive tests. I was so convinced by the evidence that medium-chain triglycerides help maintain cognitive function that I bought a coconut-oil dietary supplement for myself. If only I could remember to take it!

The Human-Animal Bond/Quality of Life Scale.
If you are an avid reader of Saber Tails, that probably means that your passionate relationship to your PBGV(s) governs your life. From the house you buy and the car you drive, to the clothes you wear and places you vacation — PBGVs rule! This extraordinarily close human-animal bond makes it difficult when your dog is terminally ill. The keynote speaker for the CHF conference was Dr. Alice Villalobos, the former president of both the American Associationof Human Animal Bond Veterinarians and of the Society for Veterinary Medical Ethics. Dr. Villalobos has an animal oncology consultation service in Woodland Hills, Calif., and an animal hospice, called Pawspice, in Hermoso Beach, Calif. The Pawspice mission statement says, “Pawspice is committed to the highest standard of compassionate cancer treatment and end-of-life palliative care to advanced stage and terminal pets by providing a unique Quality of Life Care Program.”

According to Dr. Villalobos, we need to be able to distinguish between normal senior life and end of life in our pets. In the past, veterinarians were not trained to give pets palliative care; she is trying to change that. She has developed a quality of life scale that assesses seven characteristics, which are Hurt, Hunger, Hydration, Hygiene, Happiness, Mobility and More good days than bad days. The scale is intended to help caregivers and family to monitor and improve a pet’s well being, and help them know when palliative care and hospice may be warranted, rather than curative treatment. Dr. Villalobos stressed the importance of providing terminally ill pets all necessary medications, effective pain management, adequate nutrition and hydration, proper hygiene, assistance with mobility to maintain muscle mass and healthy joints, and contentment.

The Pawspice website (pawspice.com) has excellent resources for pet owners who are facing difficult end-of-life decisions. Go to the site and click on Library to find articles on Dr. Villalobos’s quality-of-ife scale or to view her seminar at the August 2015 Southern California Veterinary Medical Association Symposium. There is also information on many types of cancer and when it is time for euthanasia.

The 2015 National Parent Club Canine Health Conference also featured presentations on gastric dilatation volvulus (commonly known as bloat), intestinal inflammation, infectious diseases, brucellosis and seizures. You will read about those talks in a future issue of Saber Tails.

Share this...

Conditioning Puppies for Hunting

By Mary Fluke, DVM
September 2015

Conditioning puppy for huntsWhen I started hunting with Iris, she didn’t have a clue what she was doing, never went in the cover, just ran the lanes and made no progress until after several hunts when she finally tripped over a rabbit. I’ve watched a lot of novice dogs try to start out in the hunt field and have seen other handlers go through the same frustration that I experienced. For dogs with no experience, whether or not they succeed in the field has more to do with luck and persistence than anything the owner can do to help them. I still remember the moment when I saw the light bulb go off for Iris, when she finally figured out that she could go in the briar patch and rustle up her own bunny and have the fun of following the trail.

Most of us get our puppies from breeders who have the show ring as their main focus. They do a wonderful job of socializing puppies, but hardly anybody makes the effort to condition puppies for hunting. When I decided to breed Iris, I had to come up with a plan to condition the puppies for hunting so they would have a head start in the field.

A few years ago, one of our judges (Sian Kwa) presented a seminar at a hunt on this very topic. She gave a memorable example using a durian (the King of all Fruit, a very stinky sulfurous fruit which tastes like butter if you can overlook the sulfites) to show that things that we smell and taste when we are very young will be familiar forever and have good associations, even though we might not appreciate them so much if we are exposed as adults. Puppies that will be raised for drug detection start playing with plastic cylinders loaded with the smell of illicit drugs while still in the whelping box. Sian, who raises Dachshunds for blood tracking, has her puppies playing with deer feet and eating deer meat as soon as they go on solid food.

I used this information to create a plan for conditioning my puppies for hunting. I started with freeze-dried bunny ears and feet, and also freezedried rabbit jerky. Once the puppies were about three weeks old, I started letting them play with the ears and feet at least once or twice a day. They showed a lot of interest and persistence, and I kept this up until Oak got big enough that one day he swallowed one of the bunny ears whole! After that, I had to be a little more circumspect in how I offered them the bunny bits.

I had taken care of the problem of early exposure to the scent. Now I needed to get the puppies used to going into cover. Fortunately, the puppies were born in the fall so the season was prime for pruning. I used branches to create a brush pile in the back yard. When the puppies were five to six weeks old, I started taking them outside to eliminate after eating and to start walking around on the outdoor surfaces (asphalt and grass). They were interested in the brush pile and played in the edges. I wanted them to be a little more adventurous, so I made a “drag” using a couple of freeze-dried bunny feet tied to a piece of twine. I threaded the twine through the brush pile, and then had a helper release a couple of puppies at a time so they could follow the drag through the brush pile. The puppies had a lot of fun working their way over and through the branches, and the best part was that I could do this in my own back yard, no running grounds required, no hunt field needed. This exercise was tons of fun to do, nothing cuter than puppies worming their way through a brush pile.Puppies going under cover.

One of the beagle guys from our local club was nice enough to fix me up with a San Juan rabbit (halfway between domestic and wild). As the puppies grew up, I gave them the chance to see and smell the rabbit in a cage. Not quite the same as turning puppies loose in a one-acre practice pen like the beagle guys do, but again, I was trying to devise a plan that anybody could do. Domestic rabbits aren’t the same as wild rabbits in terms of smell and behavior, but any rabbit is better than no rabbit — the point is to give the puppy some kind of context to connect “that smell” with “that animal.” The puppies showed some initial fearfulness when they had a chance to get close to the bunny (in a small wire cage on the ground), but they soon got over their caution and started barking and sniffing. One caveat for this exercise is to be careful to avoid the fear period that usually occurs around eight weeks — if the puppy is exposed to the caged rabbit at this critical point, the progress for hunting might be slowed down.
The final exercise was following a trail. I went to a bloodtracking seminar a few years ago and heard a couple of guys from Germany talk about conditioning puppies for following scent trails. One of the presenters said that he used buttermilk to draw a line on the floor, and then let the puppies follow the line — again, easy to do on the kitchen floor where the puppies are being raised. I tried using a drag with bunny “scent in a bottle” and food treats to create trails for the pups to follow, indoors and outdoors.

I am lucky enough to have access to a running grounds, so I had the opportunity to get the puppies on the hunt field by 10 to 12 weeks. They followed me into cover, used their noses consistently and showed wonderful promise as hunting dogs. Three of the pups from that litter have gone on to hunt very enthusiastically, and are well on their way to completing their hunt titles.

So breeders, what the heck, let the puppies play with freeze-dried bunny feet, ears or pieces of a pelt. Feed them some bunny meat, freeze dried or fresh, when they start eating solid food. Puppy buyers, when you get your new PBGV puppy, make a brush pile in your back yard and get some bunny feet to make a drag so you can introduce your new puppy to cover. Take your puppy to a meadow with tall grass, or to the woods with some low undergrowth to encourage exploration and use of nose.

Exposing the puppy to a rabbit might be a little harder from a logistical standpoint, but hopefully you can go to a hunt and participate in a puppy or novice learning experience with a caged rabbit. Use your bunny foot drag to make a trail, and drop a little piece of food every foot or so to get your puppy off to a start on tracking. These exercises are fun and pretty easy to do, even in a suburban environment. (And don’t forget to practice your recall!)

Conditioning puppies for hunting isn’t hard at all. Give it a try!PBGV hunting

Share this...

Nutrition of Aging Dogs

By Jennifer A. Larsen, DVM, PhD and Amy Farcas, DVM, MS
Vet Clin Small Anim 44 (2014) 741-759

When do our PBGVs transition from being adults to seniors? The American Animal Hospital Association suggests that dogs are considered to be seniors when they are in the last 25 percent of their predicted lifespan. The typical healthy PBGV has a lifespan of about 12 to 14 years, which means that PBGVs transition from adult to senior around 10 years of age.

How do the nutritional needs of our PBGVs change as they age? This question was addressed by Dr. Jennifer Larsen, Associate Professor of Clinical Nutrition at the University of California Davis School of Veterinary Medicine, and Dr. Amy Farcas, of the University of Pennsylvania School of Veterinary Medicine Clinical Nutrition Service. Drs. Larsen and Farcas note that older dogs may have normal physiologic changes that occur with aging and pathologic changes due to disease. Both types of changes may benefit from nutritional intervention.

Normal physiological changes associated with an aging PBGV (as well as his/her aging owner!) include changes in body composition and reduced metabolic rate. In general, older dogs have a reduced lean body mass and resting energy requirement accompanied by an increase in body fat mass. It is important to monitor body condition since obesity can exacerbate age-related diseases. Surprisingly, senior dogs have a higher prevalence of being underweight, which may be due to undiagnosed pathologic conditions. Studies have shown that senior dogs absorb nutrients as well as young dogs; however, their protein requirement increases most likely due to increased protein turnover.

Many pet food manufacturers offer canine diets targeted towards the senior population. It is important to be aware that the ideal nutritional profile of a diet for senior dogs has not been agreed upon. Thus, there is wide variation in energy density, nutrients and supplements in the senior diet.

Pathologic changes in the senior dog that may respond to nutrition include cognitive dysfunction, declining immunity and degenerative joint disease. Studies have shown that a diet enriched in anti-oxidants leads to improved behavior score, social interactions, sleep patterns, agility, learning, and recognition in dogs with cognitive dysfunction. Keeping a PBGV mentally active with games that use his/her nose may also be helpful. Dietary enrichment of anti-oxidants and vitamins also improved some aspects of immunity as measured by laboratory tests, although there was no measure of immunity of dogs against infectious disease.

The prescription for preventing degenerative joint disease in dogs is the same as for humans — maintain a healthy weight, incorporate exercise into your daily routine and eat a balanced diet. As dogs and their humans age, sarcopenia (loss of muscle mass) is a major problem that can be alleviated by meeting the requirements for protein in the diet and using the muscles. A number of nutritional supplements have been touted to be effective for treating degenerative joint disease. These include fish oils that contain long chain omega-3 polyunsaturated fatty acids, green-lipped mussel extract, glucosamine and chondroitin. Unfortunately, there is still no clear consensus for the effective dose or delivery of these compounds or method of assessment.

Drs. Larsen and Farcas note that it “should be kept in mind that each of the nutraceuticals discussed earlier for the management of age-related diseases have either an incompletely assessed efficacy or have conflicting results between subjective and objective assessments or between studies.” They conclude by saying “As dogs age, they experience a wide variety of metabolic changes that affect both structure and function. These changes may consist of normal, physiologic aging changes or may manifest as age-related disease. Screening for these changes via routine physical examination and laboratory assessment is critical to affecting the processes at stages where their courses may be altered. Accommodating the specific changes observed in each individual, rather than adopting a generic senior dog approach, will allow tailoring a patient’s treatment plan to the individual’s needs.”

Share this...

The Role of Neutering in Cancer Development

By Annette N. Smith, DVM, MS
Vet Clin Small Anim 44 (2014) 965-975

Many PBGVs in the PBGVCA community are reproductively intact because they are being actively shown or are in breeding programs. What about the dogs who are retired from the ring, are no longer being bred or are family pets? The advantages of neutering the latter group of dogs are well documented. A spayed bitch doesn’t worry about pyometra, isn’t surprised by an unplanned pregnancy and no longer has to shop in the feminine hygiene aisle of the supermarket. A castrated male is less likely to roam, fight or mount inappropriately. In addition, neutering leads to decreased risk of mammary, ovarian and uterine tumors of the female, and testicular tumors of the male. What’s not to like?

Dr. Annette Smith is Professor of Clinical Sciences at the Auburn University College of Veterinary Medicine. Her clinical specialty is oncology. Dr. Smith has gathered information from published studies on the effect of surgical sterilization on the occurrence of cancer.

Her article cites several studies that have found an increased risk of certain tumor types in surgically altered dogs. For example, osteosarcoma is more common in large and giant breeds, and neutered dogs of those breeds have a two-fold high risk for this diagnosis. Several studies have found the risk of hemangiosarcoma is many-fold greater in neutered females than intact, whereas the risk for males was less. The risks for both lymphoma and transitional cell carcinoma are higher in neutered dogs of both sexes.

Dr. Smith cites a study published in 2013 that examined the causes of death among more than 40,000 dogs presented to North American veterinary teaching hospitals from 1984 to 2004 (Hoffman, Creevy, and Promislow, 2013, PLOS ONE 8:e61082). The authors found a slight increase in life expectancy in sterilized dogs as compared to intact; however, they found large differences in the cause of death. Sterilized dogs of both sexes were much less likely to die of infectious disease (i.e., parvovirus, heartworm, canine distemper, intestinal parasites), trauma, vascular disease and degenerative disease. In contrast, the sterilized dogs were more likely to die of cancer (i.e. transitional cell carcinoma, osteosarcoma, lymphoma, mast cell tumors) and immunemediated disease. The relationship between sterilization and risk of cancer was seen in all size classes of dogs.

The bottom line is that neutering has positive effects on behaviors, noncancerous diseases and lifespan that outweigh the increased risk of cancer. It is unclear why sterilization has an effect on the risk for cancers outside of the reproductive system. Owners should be aware of the risk of cancer in their neutered hounds and discuss this with their veterinarians. Dr. Smith concludes by saying “In un-owned, shelter or rescue populations, the population benefits of neutering likely outweigh any potential for increasing cancer risk. For owned animals, veterinarians will need to discuss the pros and cons for each individual and determine the best strategy for that pet based on breed, lifestyle, longevity expectations, concurrent diseases, cancer risks, other considerations for intact and sterilized dogs, and owner preferences.”

Share this...

Metronomic Chemotherapy in Veterinary Patients with Cancer: Rethinking the Targets and Strategies of Chemotherapy

By Barbara Biller, DVM, PhD
Vet Clin Small Anim 44(2014) 817-829

Most of us have had a loved one stricken by cancer and, thus, we are familiar with the conventional cancer chemotherapeutic approach. Traditionally, a cancer patient is treated with a high dose of a drug, or drug combination, that is more toxic to rapidly dividing cancer cells than to normal tissues. The patient typically suffers side effects such as nausea, hair loss and fewer red blood cells. The treatment is followed by a break to allow drug-sensitive normal tissues to recover. Then the treatment is repeated. This conventional chemotherapy has led to improved survival for many cancer patients, but it often fails.

Dr. Barbara Biller is a veterinary oncologist at the Flint Animal Cancer Center, affiliated with Colorado State University. Her research, funded in part by the AKC Canine Health Foundation, is testing a new approach to cancer chemotherapy, called metronomic chemotherapy. A metronome is a device that produces a regular tick, tick, tick that musicians use to keep a steady tempo. Metronomic chemotherapy is the daily administration of a low dose of the same toxic drugs as conventional chemotherapy. This low dose doesn’t kill the tumor cells, but there is evidence it does prevent the growth of blood vessels into the tumor. Starved of nutrients, the tumor dies. The metronomic dose also appears to “wake up” the immune system, leading to an antitumor immune response.

Metronomic chemotherapy has been tested in several human clinical trials with patients who had advanced cancer that had failed to respond to conventional chemotherapy. Dr. Biller reports that, despite promising results, metronomic chemotherapy is still considered investigational and is not offered as a first-line therapy.

Dr. Biller cites nine published clinical trials of metronomic chemotherapy in dogs and cats. The treatment is easy to administer, reasonably priced and well tolerated. There is early evidence of overall clinical benefit. Dr. Biller states, “Although metronomic chemotherapy is an attractive treatment choice, it is still considered an experimental approach with the potential for toxicity. When available, conventional therapies should first be offered before turning to a metronomic protocol. Because stable disease is generally the goal of therapy, it is also important to consider the overall condition of the patient; living with stable disease should be expected to result in an acceptable quality of life. When used appropriately, there is much potential for metronomic chemotherapy to improve, not just maintain, quality of life for companion animals with cancer, especially as additional studies answer important questions regarding indications, drug dosages and patient monitoring.”

Share this...

Status Epilepticus and Cluster Seizures

By Edward (Ned) E. Patterson, DVM, PhD
Vet Clin Small Anim 44(2014) 1103-1112.

Epilepsy is a disorder of the brain that is characterized by recurring, unpredictable seizures. The seizures are likely due to uncontrolled electrical activity in regions of the brain, which can produce behavioral changes. When no specific cause for the seizures can be found, the disease is known as idiopathic epilepsy (IE). Young dogs (less than 1 year of age) that experience seizures often do so because of exposure to an infectious agent or to a developmental anomaly. However, the seizures could also be due to an inherited degenerative disease or metabolic disorder. Most dogs that experience their first seizure when they are much older than 5 years of age most commonly do so because of a tumor, or a late-onset degenerative or metabolic disorder. IE is the diagnosis when a specific cause for the seizures cannot be found. It typically occurs in between these very early and late cases, with an age of onset between 1 and 5 years. IE is only diagnosed after all other causes of the seizure activity have been ruled out. Most dogs with IE have a normal lifespan. However, dogs that experience seizures lasting at least five minutes or who have multiple seizures without recovery in between (known as status epilepticus) typically have a reduced survival time.

Dr. Ned Patterson is an epilepsy clinician and researcher at the University of Minnesota Clinical Investigation Center. His Canine Epilepsy Network (www.canine-epilepsy.net) is a wonderful online resource for owners and breeders of affected dogs, as well as clinicians and researchers. He gave an excellent health seminar on epilepsy at the 2009 PBGVCA National in Tucson.

In this recent article, Dr. Patterson focuses on the need for urgent and aggressive treatment for seizures that last more than a few minutes or occur back-to-back without recovery. He cites the statistic that 40 to 60 percent of dogs with idiopathic epilepsy suffer cluster seizures or status epilepticus. These are emergencies that can lead to irreversible neuronal damage. Prolonged or frequent seizures can also lead to heart and kidney damage.

Dr. Patterson outlines the general standard of practice for canine status epilepticus. Unfortunately, there has not been an expert panel consensus statement for treatment of the canine disease, as there has been for human status epilepticus. Dr. Patterson states, “There does seem, however, to be fairly similar recommendations from a number of sources that can be generally summarized as:

“1. First-line therapy should be with a benzodiazepine, which most often is intravenous diazepam, but can be by other routes and/or with midazolam, or lorazepam. There have not been any published studies comparing benzodiazepines to each other in dogs or cats as there has been for people. Shortly after the benzodiazepine, there should be intravenous loading or mini loading doses of intravenous phenobarbital or intravenous [levetiracetam] to start chronic therapy, for when the short-acting benzodiazepines wear off.

“2. In second-line therapy for continuing seizure activity, intravenous phenobarbital or intravenous LEV or a [constant rate infusion] of diazepam or midazolam should be given. The author has found that two or more of these second-line therapies can potentially be given to the same patient.

“3. Third-line therapy of [refractory status epilepticus] to induce general anesthesia can be with intravenous propofol or pentobarbital. In some instances, IV ketamine or inhalant anesthesia has been administered.”

Research over the past decade has tested new approaches, which Dr. Patterson hopes will lead to paradigm shifts in treatment for seizures. These include neurosteroids, gene therapy, use of molecules that alter gene expression, and new biochemical targets. Dr. Patterson concludes, “Status epilepticus in companion animals is an emergency and should be quickly treated by recommended first-line (emergent) therapy with benzodiazepines followed by loading doses of chronic therapy drugs, and then secondline, and third-line (refractory) therapy when needed. Cluster seizures can evolve into status epilepticus, and therefore at-home treatment with per rectum or intranasal benzodiazepines and longer-acting oral antiepileptic drugs for dogs is often recommended, and if not effective, then hospitalization for observation and treatment as for status epilepticus are recommended.”

Share this...

POAG DNA Testing & Recommendations Regarding Breeding Practices Based on Results Nov. 2011

Should We Breed With Carriers?

By Dr. Cathryn Mellersh, Animal Health Trust
November 2011
(Reprint with permission from Dr. Mellersh)

What Is a Carrier?

‘Carrier’ is the term given to an individual (of any species) that carries a single copy of a recessive mutation that is associated with a specific inherited condition, usually an inherited disorder. An individual will only suffer from a recessive disorder if it inherits two copies of the causal mutation, one from each parent. If it inherits a single copy of the mutation it will remain healthy but will pass the mutation on to about half of its offspring.

Breeding with Carriers

Once a specific disease mutation has been identified a DNA test can be developed that enables the identification of non-symptomatic carriers. Knowing which dogs carry the mutation and which don’t (the so-called ‘clear’ dogs) enables breeders to make sensible choices about the dogs they mate together. All dogs can be safely bred with provided at least one of the mating pair is clear of the mutation (see Table below). Breeding dogs that will never develop the condition should obviously be the priority for all conscientious breeders and the desire to eliminate a disease-associated mutation from a breed should therefore be the long-term goal. But the instinct to choose only clear dogs to breed from, as soon as a DNA test becomes available, may not always be a sensible choice and the rest of this document discusses why.

If carriers are prevented from breeding, the opportunity to pass the rest of their genetic material to the next generation is also lost and the genetic diversity of the remaining population is thus reduced. It is worth remembering that there is a clear and well-established link between the genetic diversity of a population and its overall health, and that breeding closely related individuals tends to lead to the accumulation of deleterious recessive mutations in the population. This is due to the fact that an individual is more likely to inherit two identical copies of a mutation if its parents share common ancestors than if they are unrelated, and the more common ancestors the parents share the greater that chance is.

It is also worth remembering that the disease mutation for which there is a DNA test is not the only mutation a carrier has. Every human, on average, carries about 50 recessive mutations and there is no reason to believe the average dog won’t carry a similar number. So the only real difference between a clear and a carrier is the single mutation that can be tested for. Both dogs will both carry around 49 other mutations that the breeder doesn’t know about and can’t test for. If carriers are not bred from and clear dogs are used extensively then there is a real risk that other mutations will increase in frequency in the breed and new inherited disease(s) could emerge.

There is no reason why the eventual elimination of a disease mutation from a breed shouldn’t be the goal, once a DNA test for that mutation becomes available. But, providing all breeding dogs are tested for the mutation prior to mating, the breeders can take their time and ensure that desirable traits are not eliminated along with the disease mutation and that the genetic diversity of the breed is not reduced.

Mutation Frequency

The speed with which the mutation can be eliminated depends on several factors, including the frequency of the mutation, the population structure and the rate of inbreeding for that breed. The more frequent the mutation is the more slowly it should be eliminated. Calculating the true frequency of a mutation is not trivial, and requires a random subset of a breed be screened. Dogs that are tested once a commercial DNA test becomes available are not always representative of the breed as a whole, and similarly cohorts of dogs that have been sampled by a research institute during development of the DNA test are also rarely characteristic of the breed.

The frequency of a mutation is typically expressed as the fraction of chromosomes in a population that carry the mutation. For example, if the frequency of a mutation is described as 0.1, this means that 10% of the chromosomes in that breed carry the mutation and the remaining 90% carry the normal copy of DNA. If 10% of the chromosomes carry the mutation then just under 20% of dogs are expected to be carriers and about 1% of dogs will be affected.

Breeding Advice

Carriers should always be included in the first one to two generations that follow the launch of a DNA test for a recessive mutation, regardless of the frequency of the mutation, to give breeders the opportunity to capture desirable traits, such as breed type and temperament, before they start to select for dogs that are clear of the mutation. Specific breeding policy for future generations should be breed-dependent and ideally formulated after consideration of factors such as the population structure and rate of inbreeding. But in general terms, carriers should only be removed from the breeding population if the frequency of the mutation is below 0.01 (1%), as this will mean only around 2% of dogs will be prevented from breeding. Avoiding carriers of a mutation that is more frequent will result in a greater number of dogs being prevented from breeding and could lead to a detrimental loss of diversity for the breed.

(PBGVCA does not provide specific medical advice, but rather provides users with information to help them better understand health and disease. Please consult with a qualified health care professional for answers to medical questions.)

Share this...

Using Canine Nomographs to Better Time Puppy Vaccinations

 

© 2017 Avidog International LLC

INTRODUCTION

We were introduced to canine nomographs 15 years ago by Dr. Ronald Schultz from the University of Wisconsin’s School of Veterinary Medicine. Since then, we have used them to time our pups’ vaccinations. This simple, inexpensive tool has enabled us to overcome the two conflicting pressures that dog breeders face— how do we ensure every puppy is fully socialized during its first 16 weeks of age while keeping them safe from distemper and parvovirus?

Nomographs have proven to be the answer for us and thousands of our colleagues and students. So, with the help of Dr. Laurie at the Schultz Lab, we have written this ebook for other breeders. We hope it will be useful to you!

Like you, we are simply dog breeders so be sure to discuss this process with your veterinarians! Feel free to share this booklet with them.

Gayle, Marcy and Lise

Our thanks to the Schultz Lab, Dr. Ron Schultz and Dr. Laurie Larson for providing this invaluable service to dog breeders and puppy owners across North America!! Please visit the lab’s website for more information and details.

https://www.vetmed.wisc.edu/lab/Schultz/

WHAT ARE CANINE NOMOGRAPHS?

Nomographs are simple blood tests that estimate the amount of distemper and parvovirus antibodies passed from a dam to her puppies via her colostrum, or first milk. Nomographs are useful for breeders and puppy owners because they can help predict when pups:

  • are no longer protected by maternal antibodies and
  • will be able to respond to distemper and/or parvo vaccines.

During a puppy’s first 12 hours of life, its intestinal tract allows antibodies in colostrum to pass into the bloodstream and thus start protecting it from the diseases that its mother is protected from. As the puppy grows up, maternal antibodies break down in approximately two-week “half lives” until they are no longer present in the pup.

While a puppy’s maternal antibodies are high, they neutralize viruses such as canine parvovirus and canine distemper virus. This keeps the pup safe from these potentially fatal diseases. However, this same neutralization also blocks vaccines so the puppy will not able to be immunized.

Maternal antibodies against distemper and parvo are independent of each other; a bitch can and usually will have different levels of protection against these diseases. In our experience, bitches’ titers can range from as low as 4 and as high as 5280. These levels mean a pup’s maternal antibodies can disappear as early as a few days after birth to as late as 18 weeks of age! With these last pups, if we had stopped vaccinating them at 16 weeks, as is commonly done, the pups would not have been protected!

In fact, maternal antibody interference is one of the most common causes of vaccine failure in puppies! We usually give pups multiple doses of vaccine every two to three weeks during puppyhood because we don’t know their maternal antibody titers. So, we don’t know when a vaccine will be effective. Nomograph testing helps us understand the best timing of vaccination to ensure a litter will be effectively immunized with the fewest vaccines as early as possible in their life.

We can measure the antibodies that a bitch has to pass on to her puppies using antibody titers, a simple blood test. If that test is done at the Schultz Laboratory at the University of Wisconsin Veterinary School, a nomograph can then be run on those results, allowing us to predict the optimal time to vaccinate her puppies.

USING A NOMOGRAPH FOR YOUR LITTER
To use a nomograph to better time your litter’s distemper and parvo vaccinations, you will need to ship serum from your bitch to the Schultz lab. The ideal time for the blood draw is either two weeks before or two weeks after the puppies are whelped. You may find it more convenient to do the blood draw when your bitch is at your veterinarian’s for progesterone testing or a pregnancy ultrasound. Similarly, bitches that are bred more than once a year do not have to have a second nomograph that year. However, the further from whelping the blood is drawn, the more risk you take that your bitch has come in contact with distemper or parvo and mounted an immune response that won’t be revealed in her titer. You’ll have to decide how great that risk is based on your bitch’s activities and the amount of parvo or distemper in your area. Personally, we stick with drawing blood either two weeks before or two weeks after whelping.

Prepare and ship the blood according to the Blood Preparation Procedures in the next section and the Nomograph Submission Form on page 10. Follow the example submission form on page 11. It is particularly helpful to the lab if you provide your dam’s vaccination history. At a minimum, fill out her distemper (CDV) and parvovirus (CPV-2) vaccination history.

Nomograph Report. In about a week, you will receive an email report from the lab similar to the one on page 12. The report will give you your bitch’s parvo and distemper titers in the box, and then below that is the protective standard for this lab. A little further down the page will be the nomograph information for the litter, indicating the age at which the pups can be vaccinated and for which diseases. On these reports, D indicates a distemper vaccine, A indications an adenovirus-2 vaccine, and P indicates a parvovirus-2 vaccine. The report then goes on to give further information about confirming the pups’ immune response.

Pups’ “At-Risk” Period. Prior to the recommended vaccination dates, the pups are at risk for getting distemper or parvo if they come in contact with it. At the same time, it is critical that we fully socialize and develop our pups prior to 16 of age. So breeders must practice good biosecurity while still socializing puppies during the weeks prior to the vaccinations. If you want to know more about how to do this, check out Avidog’s Transformational Puppy Rearing video series (www.avidog.com/request-rbp-vod/).

Send Reports to New Homes. Provide a copy of the nomograph report with each pup’s vaccination record to its new owners so they can provide them to their veterinarian on the first visit. This enables the pup’s vet to tailor the pup’s vaccines to its individual needs.

Confirming Pups’ Responses to Vaccines. Every pup, no matter what vaccination protocol it receives, should have a confirmatory titer drawn to ensure that it is protected. We have personally bred litters that could and did not respond to the parvo vaccine until after 17 weeks of age. If their owners had stopped vaccinating at the typical 16 weeks, those pups would have been left unprotected against parvo. They would have had a good chance of coming down with the disease in their first year, since they were competition dogs and thus out and about.

You or your owners can use the Schultz lab for your pups’ confirmatory titers. Use the same submission form and blood draw instructions but this time, do not check the nomograph block. Attach a copy of the dam’s nomograph with the submission form. You will receive a report like the one on page 13.

If an owner doesn’t do a confirmatory titer after the puppy series, that pup should be vaccinated against distemper, parvo and adeno at a year of age, when all chance of maternal antibodies is gone.

High Risk Conditions. In high risk situations, such as kennels that have had parvo outbreaks, you should take the additional step of running a titer on at least one pup in a litter BEFORE vaccination is begun. The nomograph on the dam is helpful, but a pup’s actual antibody level provides even better information in this risky situation.

When Not to Use Nomographs. Nomographs are useful tools to help breeders predict when vaccinations can be successful in their pups. However, to successfully use nomographs to schedule a puppy’s distemper and parvovirus vaccines, that puppy must have ingested colostrum from its dam during its first 12 hours of life. If for some reason that did not happen, either due to issues with the puppy or its mother, then a nomograph cannot be used and the puppy should be vaccinated using the more standard vaccination protocols, like those recommended by the World Small Animal Veterinary Association, which can be found at www.wsava.org/guidelines/vaccination-guidelines.

BLOOD PREPARATION PROCEDURES FOR A NOMOGRAPH

☐ Plan to draw your bitch’s blood two weeks prior to or two weeks after whelping. Avoid drawing blood closer to whelping than these dates because the bitch’s body is creating colostrum and the nomograph will be less accurate. At the same time, if you draw her blood too far from whelping, you risk her coming in contact with distemper or parvo closer to whelping, which will change the antibody levels the pups get in her colostrum.

☐ Ship your bitch’s blood to arrive at the lab Monday through Friday. Drawing and shipping blood Monday, Tuesday or Wednesday is usually best.

☐ Collect 1 to 3 mls of blood from your bitch in a sterile, red top or serum separator tube and allow it to clot.

☐ Spin down to separate the serum. Send at least ½ ml of serum for the testing.

☐ Wrap the tube with the serum in padding, such as paper towel, and place it in a plastic zip-lock bag.

☐ Fill out the submission form (see sample form) and place it with a $25 check made payable to the University of Wisconsin in a SECOND plastic zip-lock bag. (Please note this fee is expected to go up at some point in 2017, so you may want to call the lab to ensure you send the proper amount.)

☐ Place both plastic bags in a sturdy shipping container, either a padded envelope or box. If the ambient temperature might go above 80°F during shipping, include a cold pack wrapped with some newspaper to keep it from crushing the serum vial. Freezing temperatures aren’t a concern when shipping separated serum.

☐ Send the shipping container via USPS 2-day Priority Mail to this address. Overnight shipping is not necessary.

Dr. R.D. Schultz Laboratory
4337 School of Veterinary Medicine
2015 Linden Drive West
Madison, WI 53706
(608) 263-4648

☐ The lab usually runs tests on Fridays and will send you and your vet a report via email (see sample report) that gives you the following, usually a week after receiving the blood sample:

  • your bitch’s quantitative titers for distemper and parvo,
  • an interpretation of these results for her, and
  • recommendations for which weeks to vaccinate her puppies.

RESOURCES

American Veterinary Society of Animal Behavior. 2008. AVSAB Position Statement On Puppy Socialization. Available at http://www.avidog.com/wp-content/uploads/2014/02/AVSAB-Position-on-Puppy-Socialization.pdf

Baker JA, Robson DS, Gillespie JH, Burgher JA, Doughty MF. 1959. A nomograph that predicts the age to vaccinate puppies against distemper. Cornell Vet. 1959 Jan;49(1):158–167.

Ronald D Schultz Lab. 2016. Canine Nomograph – What is it? Available at www.vetmed.wisc.edu/lab/schultz/canine-nomograph-what-is-it/

WSAVA Vaccination Guidelines Group. 2015. World Small Animal Veterinary Association 2015 Vaccination Guidelines for The Owners and Breeders of Dogs and Cats. Available at http://www.avidog.com/wp-content/uploads/2016/12/WSAVA-Owner-Breeder-Guidelines-14-October-2015-FINAL-1.pdf

NOMOGRAPH SUBMISSION FORM For Dr. R.D. Schultz Lab Click Here

Avidog International provides continuing professional education for dog breeders based on current and past research, as well as over 60 years of joint breeding experience.  Visit our Breeder College for courses, products, ebooks and more.

Avidog International LLC
PO Box 959
Mattituck, NY 11952
info@avidog.com
(800) 305-2808 
www.Avidog.com

(PBGVCA does not provide specific medical advice, but rather provides users with information to help them better understand health and disease. Please consult with a qualified health care professional for answers to medical questions.)

Share this...

A Novel Genome-Wide Association Study Approach Using Genotyping by Exome Sequencing Leads to the Identification of a Primary Open Angle Glaucoma Associated Inversion Disrupting ADAMTS17 (12/18/2015)

PLOS ONE | DOI:10.1371/journal.pone.0143546  December 18, 2015

RESEARCH ARTICLE

A Novel Genome-Wide Association Study Approach Using Genotyping by Exome Sequencing Leads to the Identification of a Primary Open Angle Glaucoma Associated Inversion Disrupting ADAMTS17

Oliver P. Forman1*, Louise Pettitt1, András M. Komáromy3, Peter Bedford2, Cathryn Mellersh

* oliver.forman@aht.org.uk

  1. Kennel Club Genetics Centre, Animal Health Trust, Newmarket Suffolk, CB8 7UU, United Kingdom,
  2. Department of Clinical Science & Services, Royal Veterinary College, University of London, Hawkshead Lane, Hatfield, Hertfordshire, AL9 7TA, United Kingdom, 3 Department of Small Animal Clinical Sciences, College of Veterinary Medicine, Michigan State University, Veterinary Medical Center, 736 Wilson Road, East Lansing, MI, 48824–1314, United States of America

Abstract

Closed breeding populations in the dog in conjunction with advances in gene mapping and sequencing techniques facilitate mapping of autosomal recessive diseases and identification of novel disease-causing variants, often using unorthodox experimental designs. In our investigation we demonstrate successful mapping of the locus for primary open angle glaucoma in the Petit Basset Griffon Vendéen dog breed with 12 cases and 12 controls, using a novel genotyping by exome sequencing approach. The resulting genome-wide association signal was followed up by genome sequencing of an individual case, leading to the identification of an inversion with a breakpoint disrupting the ADAMTS17 gene. Genotyping of additional controls and expression analysis provide strong evidence that the inversion is disease causing. Evidence of cryptic splicing resulting in novel exon transcription as a con- sequence of the inversion in ADAMTS17 is identified through RNAseq experiments. This investigation demonstrates how a novel genotyping by exome sequencing approach can be used to map an autosomal recessive disorder in the dog, with the use of genome sequencing to facilitate identification of a disease-associated variant.

Introduction
It is well documented that population structure in the purebred dog can help to facilitate genome-wide association study (GWAS) approaches [1]. The development of most modern breeds within the last 200 years from small numbers of founding individuals has led to high levels of linkage disequilibrium (LD) within breeds. These high levels of LD lead to very strong signals of association being produced from GWASs for autosomal recessive diseases, even with very modest sample numbers [2]. Closed breeding populations, high levels of inbreeding and the extensive use of popular sires (dogs that closely fit the standard for a particular breed) can lead to rapidly emerging autosomal recessive disorders, as rare deleterious alleles are rapidly amplified. An example of an emerging autosomal recessive disorder is primary open angle glaucoma (POAG) in the Petit Basset Griffon Vendéen (PBGV).

The first recognised case of POAG in the PBGV was identified in the United Kingdom in 1996 and recent survey work completed in 2014 has demonstrated a 10.4% prevalence for the disease (personal communication, Peter Bedford). The initial clinical features of POAG are usually seen in 3 to 4 year old dogs of either sex, the disease being characterised by a small, sustained rise in intraocular pressure (IOP) and lens subluxation. In approximately one third of affected dogs phacodonesis and the appearance of the aphakic crescent associated with lens subluxation are seen before a noticeable rise in IOP (Fig 1). There is no pectinate ligament abnormality and the iridocorneal angle remains open until the late stages of the disease, when globe enlargement has developed. Retinal degeneration and a cupping deformation of the optic papilla are only seen in late disease. Pain is not a feature and the quiet, chronic clinical nature of this disease means that often owners only become aware of the presence of POAG when either the globe enlargement or a vision problem becomes noticeable.

As POAG is an autosomal recessively inherited disease, mapping of which are facilitated by the high levels of LD described, we designed a novel GWAS approach using genotyping by exome sequencing methodology with 12 cases and 12 controls with the dual aim of identifying both the disease-associated locus and causal variant for POAG through a single experiment.

Fig 1. POAG case eye image. Left eye, 4 year old male PBGV: The eye is normotensive (18 mm. Hg.), but an aphakic crescent indicating lens subluxation is visible within the dorsal part of the dilated pupillary aperture.

Results
Genome-wide association study by exome sequencing (POAG)

Exome sequencing was carried out using a commercially available human exome capture kit to capture the exomes of 12 POAG cases and 12 breed matched control dogs. Illumina sequencing produced a 15.0 Gb dataset of 250 bp paired-end reads (sufficient for low coverage of ~5x). Alignment to the canine reference sequence CanFam3.1 and variant calling across all 24 individuals identified a total of 841,115 SNP and indel calls (variants). After filtering variants with a minor allele frequency (MAF) of less than 5% and genotyping frequency (GF) of less than 80%, 61,977 remained.

Basic allele association analysis identified a single signal of genome-wide significance on canine chromosome 3 (praw = 6.15×10-10)(Fig 2). The genomic inflation factor (based on median chi-squared) was 1.34. Correction for the effects of population substructure was performed using a mixed model approach (EMMAX) [3] and the strong single signal on chromo-some 3 remained (p = 1.34×10-9)(S1 Fig). The adjusted genomic inflation factor (based on median chi-squared) was 1.04.

Fig 2. Allelic association plot for POAG GWAS. Exome sequencing was used to generate SNPs for 12 POAG cases and 12 controls. Allelic association analysis identified a single signal on chromosome 3 of genome-wide significance.
Fig 3. Genotyping data across the POAG disease-associated interval. Visualisation of the genotyping dataset across chromosome 3 was used to identify the disease-associated interval. Loss of homozygosity in cases defined the boundaries of the associated interval (orange dashed lines). Minor alleles are shown in yellow and major alleles in blue.

Visual analysis of the raw genotyping data revealed a disease associated interval of chr3:40,153,292–47,300,360 based on the CanFam3.1 genome build (Fig 3). All cases were homozygous for the disease-associated haplotype. The disease-associated interval contained 28 genes, including ADAMTS17, a potential glaucoma candidate gene. A list of interval genes can be found in S1 Table. As all cases were homozygous for the disease-associated haplotype the exome sequencing datasets were combined for all cases to increase read depth for interrogation of the disease-associated interval. As the human kit was used for target enrichment, capture of canine exons was incomplete (approximately 80%). For ADAMTS17 additional exon resequencing was performed to cover all exons, in three POAG cases and three controls, although no coding or splice site variants were identified.

The SNP with the lowest p-value from the GWAS (top SNP) was a non-synonymous SNP in the SYMN gene (chr3:41,599,598). Conservation analysis across vertebrate species showed weak conservation of this residue, with a number of naturally occurring amino acids at this position. The variant is also predicted to be tolerated by SIFT. In total, 2,696 SNPs and indels were identified across the disease-associated interval, including 12 non-synonymous variants, although none segregated fully with disease status (i.e. homozygotes for the non-reference allele were present in both case and control sets). A list of non-synonymous variants with consequent predictions is shown in S2 Table.

The disease-associated interval was further investigated by genome resequencing of a single POAG case. To consider intronic, exonic and intergenic regions in detail, sequence read align-ments were visually scanned using the Integrative Genomics Viewer (IGV) [4]. Sequence read alignments indicative of a 4.96 Mb inversion were identified with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123) (Fig 4).

Expression analysis
To gauge whether the inversion had an impact on gene expression, limited qRT-PCR experiments were performed. Tissues for RNA extraction were selected based on the availability of suitable case and control material and assessment of

Fig 4. The POAG associated inversion. (A) Reads aligning across the inversion breakpoints. Red reads indicate a greater than expected insert size. Read mates for red reads align in the same direction, indicative of an inversion. There were five deleted bases at the 5’ inversion breakpoint and 78 deleted bases at the 3’ deletion breakpoint. Green boxes indicate repeat elements. (B) Overview of the genomic region covered by the inversion. The inverted region is highlighted in blue. Genotyping of the inversion was carried out to confirm the association with POAG. A total of 225 PBGVs were genotyped, including 28 POAG cases, of which 27 were homozygous for the inversion. Results are summarized in Table 1.

expression levels of ADAMTS17 using RNAseq data generated in previous studies (data not shown). In a comparison of retinal cDNA from one POAG case against one control, results suggested a 2.4 fold increase in ADAMTS17 expression upstream of the inversion for the POAG case relative to the control. No ADAMTS17 expression was detected downstream of the inversion for the POAG case. (Full results are shown in S1 Dataset).

RNAseq data generated from retinal RNA of one POAG case, showed concordance with the results of qPCR analysis. Expression of novel exons as the result of cryptic splicing was observed after the final normally transcribed exon of ADAMTS17 before disruption by the inversion. An example of a novel exon established through a cryptic splicing event is shown in Fig 5. A schematic diagram of ADAMTS17 exon arrangement is shown in Fig 6.

Table 1. Genotyping of an extended PBGV sample set for the POAG-associated inversion.

Results of genotyping 212 PBGV for the POAG associated inversion, where + represents the reference allele and INV represents the inversion allele.
Fig 5. Example of novel exon formation through cryptic splicing. An example of a novel exon occurring due to a cryptic splicing event visualised through aligned RNAseq reads. A splice donor site and reads spanning to the previous exon (solid red) can be identified. There are no reads aligning to the region for the control individual (lower panel).

Both of the sequences of the two independent novel exons contained stop codons after an aberrant sequence of amino acids (S1 File).

Discussion

In this investigation we have demonstrated a novel GWAS approach using exome sequencing variants calls as the genotyping dataset. The major potential advantage of this approach is that a causal variant for a single gene disease could be identified in a single step, and would theoretically be the most strongly disease segregating variant with the lowest associated p-value (top SNP). Although the causal variant for POAG was not directly found by this method, due to the non-exonic location, a genome-wide significant locus was identified, enabling a disease-associated interval to be determined.

The causal mutation for POAG was eventually identified through a genome sequencing approach. Genome sequencing is an increasingly cost effective method of following up disease-associated intervals identified through GWAS. In contrast to other approaches such as exome sequencing and target enrichment, coverage is near to 100%, enabling identification of causal mutations in repetitive regions of the genome. Genome sequencing has recently been adopted to directly identify causal mutations in the dog [5–7] and is being used in human studies through projects such as the 100,000 genomes project, studying cancers and rare diseases [8]. However, structural variants still often present a challenge to smaller laboratories using genome sequencing as part of an investigation, making GWAS in many cases the most appropriate method of locus identification for single gene diseases, before using genome sequencing or other approaches to interrogate disease-associated intervals.

Fig 6. Schematic gene arrangements for the reference and inversion alleles. Transcript arrangements for the ADAMTS17 reference gene and ADAMTS17 after the inversion event. Novel exons are marked with an asterisk.

Although the ADAMTS17 gene was majorly disrupted by the inversion, qPCR analysis on a limited number of samples showed little evidence of nonsense mediated decay, as expression of exons outside of the inverted region was not majorly affected. Analysis of RNAseq data revealed novel exon expression for ADAMTS17 due to cryptic splicing occurring 3′ of the exons located immediately upstream of the inversion event. The unavailability of suitable anti-bodies targeting the 5’ region of ADAMTS17 prevented western blot analysis to determine whether protein is still produced from the modified transcript sequence. Visual analysis of RNAseq data aligned to the genes flanking and within the inversion region suggested gene expression for these genes was not affected. We speculate that a mobile element (SINE) which spans the 3′ inversion breakpoint is likely to have been involved in the inversion mechanism, although there is no similar mobile element in the 5′ region. There is one previous report of a gene rearrangement involving ADAMTS17 found in a patient with pregnancy-related acute promyelocytic leukemia [9]. This rearrangement resulted in a novel transcription product with the insertion of exon 15 of ADAMTS17 between the PML and RARA genes. As the breakpoint within ADAMTS17 identified in this study was within intron 12, it is unlikely that the mutation mechanism was shared between these two independent events.

Genotyping of an extended sample set was used to determine whether the identified inver-sion was fully concordant with POAG. Of the 212 PBGV assayed for the POAG associated inversion there was one discordant case. A single dog was reported as having clinical signs of POAG but was homozygous for the reference sequence. It could be speculated that POAG for this case is due to another clinical or genetic cause, or is a secondary form of glaucoma.

A Weill-Marchesani like syndrome (WMS) in humans was the first disease phenotype to be associated with mutations in the ADAMTS17 gene. Clinical signs of WMS include glaucoma, ectopia lentis (lens luxation), lenticular myopia, spherophakia, and short stature [10]. It is interesting to speculate that as the PBGV is a miniature version of the Grand Basset Griffon Vendéen, artificial selection pressure for small size may have contributed to an increase in mutant allele frequency, assuming mutations in ADAMTS17 could be contributing to small stature. An ADAMTS17 splice donor site mutation has been associated with hereditary primary lens luxation in several breeds of dog [11, 12]. The range of phenotypes associated with ADAMTS17 mutations suggests that the exact phenotypic presentation is dependent on the positioning and nature of the mutations within the ADAMTS17 gene. The ADAMTS17 gene is a member of the ADAMTS family of extracellular proteases [13]. Domains which are characteristic of the ADAMTS family include an N terminal protease domain and a C-terminal ancillary domain [14]. The inversion in intron 12 of ADAMTS17 is within the proteolytic domain and is therefore likely to disrupt the enzymatic function of the protein. Phenotypic similarities between ADAMTS associated disease and Fibrillin1 (FBN1) associated disease, and functional evidence, suggest ADAMTS family members have a role in microfibril assembly and function [15]. It could be speculated that disruption of the maintenance of microfibrils in the eye are likely to lead to development of disease phenotypes such as lens luxation and glaucoma [16]. The role of the ADAMTS family members in glaucoma pathogenesis is further highlighted by the identification of a mutation in ADAMTS10 as the cause of glaucoma in the Beagle and Norwegian Elkhound dog breeds [17, 18]. Functional work would be required to further understand the roles of the ADAMTS family in glaucoma disease pathogenesis.

In summary, we have used a novel GWAS approach and genome sequencing to identify an inversion associated with POAG in the PBGV dog breed. The approach further highlights how the increasing availability and cost effectiveness of massively parallel sequencing are facilitating studies into inherited disease in the dog.

Materials and Methods
Ethics Statement

Collection of DNA samples was performed by buccal swabbing, which is a non-invasive technique that does not require a United Kingdom Home Office License. Only pet dogs were used in the study with full owner consent. Tissue samples for the study into primary open angle glaucoma were obtained after enucleation of a glaucoma case by a veterinary ophthalmologist on welfare grounds due to the severity of clinical signs (carried out in accordance with the Veterinary Surgeons Act 1966 and under the auspices of the RCVS). Full owner consent was obtained. As the techniques used were either non-invasive or in the case of eye surgery, were required to alleviate animal suffering rather than for research purposes, no ethics committee approval was required.

Diagnosis of POAG cases, and sample set selection

All cases of POAG were diagnosed by a specialist veterinary ophthalmologist. The basic clinical examination for POAG involves the use of slit lamp biomicroscopy, both indirect and direct ophthalmoscopy, applanation tonometry and gonioscopy. Tonometry and gonioscopy are completed before inducing mydriasis using 1% tropicamide, slit lamp biomicroscopy utilised pre and post mydriasis and ophthalmoscopy post mydriasis. Vision assessment is based on history, the menace and dazzle reflexes and, where possible, maze performance.

DNA extraction and genotyping

DNA was extracted from buccal swabs using the QIAamp Midi kit (Qiagen). Genotyping of the POAG associated inversion was performed by analysis of a fragment length polymorphism generated by PCR. Primers for PCR were as follows: POAG_F, 6FAM-AGGCTCAGAGGAGGG TGACT; POAG_R1, ACAAGGACAAAGCTGTCTGTGA; POAG_R2, ACACAAAGCACCCATGAC AG. PCRs were carried out in 12 ul volumes consisting of 1.5 mM dNTPs, 1x Qiagen PCR buffer, 0.5 µM of each primer, 0.6U of Qiagen HotStarTaq polymerase and template DNA. Thermal cycling consisted of 5 minutes at 95°C, followed by 35 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds, with a final elongation stage of 72°C for 5 minutes. Products of PCR were analysed using the fragment analysis module of an ABI3130xl genetic analyser. Sequencing of the ADAMTS17 gene was carried out as previously described [11].

Exome sequencing and allelic association analysis

Libraries for exome sequencing of 12 POAG cases and 12 breed matched controls were made using the Illumina Nextera Exome Enrichment kit according to the manufacturer’s instructions. Libraries were quantified by qPCR using the KAPA library quantification kit. Sequencing of libraries was performed using two runs on the Illumina MiSeq platform, generating paired-end reads of 250 bp in length. The sequence reads generated were aligned to the canine reference genome build, CanFam3.1 using BWA [19]. Variants were called using the GATK [20]. Variants were converted to PLINK format for use in allelic association analysis using VCFtools [21]. Allelic association analyses were carried out using the whole genome data analysis toolset, PLINK [22]. Genome sequencing was outsourced to the Wellcome Trust Centre for Human Genetics, Oxford. Sequencing data can be found in the European Nucleotide Archive, study accession number PRJEB11835.

Expression analysis

RNA was extracted from retina using the Qiagen RNeasy Midi kit, and included an on column DNase treatment. Isolation of mRNA from total RNA was performed using Sera-Mag oligo-dT beads. Libraries for RNAseq were generated using NEBNext Ultra RNA Library Prep Kit for Illumina sequencing. Sequencing was performed on an Illumina MiSeq generating a dataset of 75 bp paired-end reads, using one run per RNAseq library. Approximate dataset sizes were 4 Gb.

Synthesis of cDNA for qPCR expression analysis was performed using the Qiagen Quantitech reverse transcription kit. Expression analysis by qPCR was performed in 8 µl reactions, containing 1x primer- probe mix, 1x KAPA Probe Fast qPCR Master Mix and 2 µl template cDNA. Standard curves were generated over a seven point, two fold dilution. Standard curves for all qPCR assays had an r2 of greater than 0.99 and all assays had an efficiency of greater than 95%. Primers for qPCR, reaction efficiencies and full datasets with calculations can be found in S1 Dataset.

Supporting Information

S1 Dataset. qRT-PCR primer sequences, reaction efficiencies and calculations.(XLSX)
S1 Fig. Association analysis using a Mixed Model approach correcting for population structure for the POAG GWAS.
(TIF)
S1 File. Sequence information for novel ADAMTS17 exons.(DOCX)
S1 Table. Genes in the disease-associated interval for POAG.(DOCX)
S2 Table. Non-synonymous SNP variants in the POAG disease-associated interval.(DOCX)

Acknowledgments

We are thankful to all owners, breeders and clinicians that have contributed samples to this study. We thank the High-Throughput Genomics Group at the Wellcome Trust Centre for Human Genetics for the generation of the sequencing data.

Author Contributions

Conceived and designed the experiments: OPF CM. Performed the experiments: OPF LP. Ana-lyzed the data: OPF. Contributed reagents/materials/analysis tools: OPF AMK PB CM. Wrote the paper: OPF LP AMK PB CM.

References

  1. Parker HG, Kukekova AV, Akey DT, Goldstein O, Kirkness EF, Baysac KC, et al. Breed relationships facilitate fine-mapping studies: a 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds. Genome research. 2007; 17(11):1562–71. doi: 10.1101/gr.6772807 PMID: 17916641; PubMed Central PMCID: PMC2045139.
  2. Safra N, Bassuk AG, Ferguson PJ, Aguilar M, Coulson RL, Thomas N, et al. Genome-wide association mapping in dogs enables identification of the homeobox gene, NKX2-8, as a genetic component of neu-ral tube defects in humans. PLoS Genet. 2013; 9(7):e1003646. doi: 10.1371/journal.pgen.1003646 PMID: 23874236; PubMed Central PMCID: PMC3715436.
  3. Kang HM, Sul JH, Service SK, Zaitlen NA, Kong SY, Freimer NB, et al. Variance component model to account for sample structure in genome-wide association studies. Nat Genet. 2010; 42(4):348–54. doi: 10.1038/ng.548 PMID: 20208533; PubMed Central PMCID: PMC3092069.
  4. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative geno-mics viewer. Nat Biotechnol. 2011; 29(1):24-6. doi: 10.1038/nbt.1754 PMID: 21221095; PubMed Central PMCID: PMC3346182.
  5. Gilliam D, O’Brien DP, Coates JR, Johnson GS, Johnson GC, Mhlanga-Mutangadura T, et al. A homozygous KCNJ10 mutation in Jack Russell Terriers and related breeds with spinocerebellar ataxia with myokymia, seizures, or both. Journal of veterinary internal medicine / American College of Veterinary Internal Medicine. 2014; 28(3):871-7. doi: 10.1111/jvim.12355 PMID: 24708069; PubMed Central PMCID: PMC4238845.
  6. Guo J, Johnson GS, Brown HA, Provencher ML, da Costa RC, Mhlanga-Mutangadura T, et al. A CLN8 nonsense mutation in the whole genome sequence of a mixed breed dog with neuronal ceroid lipofuscinosis and Australian Shepherd ancestry. Molecular genetics and metabolism. 2014; 112(4):302–9. doi: 10.1016/j.ymgme.2014.05.014 PMID: 24953404.
  7. Guo J, O’Brien DP, Mhlanga-Mutangadura T, Olby NJ, Taylor JF, Schnabel RD, et al. A rare homozygous MFSD8 single-base-pair deletion and frameshift in the whole genome sequence of a Chinese Crested dog with neuronal ceroid lipofuscinosis. BMC veterinary research. 2014; 10:960. doi: 10.1186/s12917-014-0181-z PMID: 25551667; PubMed Central PMCID: PMC4298050.
  8. Siva N. UK gears up to decode 100,000 genomes from NHS patients. Lancet. 2015; 385(9963):103–4. doi: 10.1016/S0140-6736(14)62453-3 PMID: 25540888.
  9. Lim G, Cho EH, Cho SY, Shin SY, Park JC, Yang YJ, et al. A novel PML-ADAMTS17-RARA gene rear-rangement in a patient with pregnancy-related acute promyelocytic leukemia. Leukemia research. 2011; 35(7):e106–10. doi: 10.1016/j.leukres.2011.03.020 PMID: 21529941.
  10. Morales J, Al-Sharif L, Khalil DS, Shinwari JM, Bavi P, Al-Mahrouqi RA, et al. Homozygous mutations in ADAMTS10 and ADAMTS17 cause lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. Am J Hum Genet. 2009; 85(5):558–68. doi: 10.1016/j.ajhg.2009.09.011 PMID: 19836009; PubMed Central PMCID: PMC2775842.
  11. Farias FH, Johnson GS, Taylor JF, Giuliano E, Katz ML, Sanders DN, et al. An ADAMTS17 splice donor site mutation in dogs with primary lens luxation. Invest Ophthalmol Vis Sci. 2010; 51(9):4716–21. Epub 2010/04/09. iovs.09-5142 [pii] doi: 10.1167/iovs.09-5142 PMID: 20375329.
  12. Gould D, Pettitt L, McLaughlin B, Holmes N, Forman O, Thomas A, et al. ADAMTS17 mutation associated with primary lens luxation is widespread among breeds. Vet Ophthalmol. 2011; 14(6):378–84. doi: 10.1111/j.1463-5224.2011.00892.x PMID: 22050825.
  13. Porter S, Clark IM, Kevorkian L, Edwards DR. The ADAMTS metalloproteinases. The Biochemical journal. 2005; 386(Pt 1):15–27. doi: 10.1042/BJ20040424 PMID: 15554875; PubMed Central PMCID: PMC1134762.
  14. Mosyak L, Georgiadis K, Shane T, Svenson K, Hebert T, McDonagh T, et al. Crystal structures of the two major aggrecan degrading enzymes, ADAMTS4 and ADAMTS5. Protein science: a publication of the Protein Society. 2008; 17(1):16–21. doi: 10.1110/ps.073287008 PMID: 18042673; PubMed Central PMCID: PMC2144589.
  15. Hubmacher D, Apte SS. Genetic and functional linkage between ADAMTS superfamily proteins and fibrillin-1: a novel mechanism influencing microfibril assembly and function. Cellular and molecular life sciences: CMLS. 2011; 68(19):3137–48. doi: 10.1007/s00018-011-0780-9 PMID: 21858451.
  16. Kuchtey J, Kuchtey RW. The microfibril hypothesis of glaucoma: implications for treatment of elevated intraocular pressure. Journal of ocular pharmacology and therapeutics: the official journal of the Association for Ocular Pharmacology and Therapeutics. 2014; 30(2-3):170-80. doi: 10.1089/jop.2013.0184 PMID: 24521159; PubMed Central PMCID: PMC3991966.
  17. Kuchtey J, Olson LM, Rinkoski T, Mackay EO, Iverson TM, Gelatt KN, et al. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma. PLoS Genet. 2011; 7(2):e1001306. doi: 10.1371/journal.pgen.1001306 PMID: 21379321; PubMed Central PMCID: PMC3040645.
  18. Ahonen SJ, Kaukonen M, Nussdorfer FD, Harman CD, Komaromy AM, Lohi H. A novel missense mutation in ADAMTS10 in Norwegian Elkhound primary glaucoma. PLoS One. 2014; 9(11):e111941. doi: 10.1371/journal.pone.0111941 PMID: 25372548; PubMed Central PMCID: PMC4221187.
  19. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009; 25(14):1754–60. Epub 2009/05/20. btp324 [pii] doi: 10.1093/bioinformatics/btp324 PMID: 19451168; PubMed Central PMCID: PMC2705234.
  20. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010; 20(9):1297-303. Epub 2010/07/21. gr.107524.110 [pii] doi: 10.1101/gr.107524.110 PMID: 20644199; PubMed Central PMCID: PMC2928508.
  21. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, et al. The variant call format and VCFtools. Bioinformatics. 2011; 27(15):2156–8. doi: 10.1093/bioinformatics/btr330 PMID: 21653522; PubMed Central PMCID: PMC3137218.
  22. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. American journal of human genetics. 2007; 81(3):559–75. doi: 10.1086/519795 PMID: 17701901; PubMed Central PMCID: PMC1950838.

(PBGVCA does not provide specific medical advice, but rather provides users with information to help them better understand health and disease. Please consult with a qualified health care professional for answers to medical questions.)

Share this...

Open-angle glaucoma in the Petit Basset Griffon Vendeen By Professor Peter G. C. Bedford (2016)

REPRINT FROM: Veterinary Ophthalmology (2017) 20, 2, 98–102 DOI:10.1111/vop.12369
2016 American College of Veterinary Ophthalmologists, Veterinary Ophthalmology

Open-angle glaucoma in the Petit Basset Griffon Vendeen
Peter G. C. Bedford*,†
*Professor Emeritus of Veterinary Ophthalmology, Royal Veterinary College, London, UK; and †Ophthalmology Referrals, 25, Great North Road, Brookmans Park, Herts. AL9 6LB, UK

Abstract
Objectives To report the prevalence and clinical characteristics of an open-angle glaucoma in Petit Basset Griffon Vendeen (PBGV) dogs in the United Kingdom (UK). Animals studied and methods At breed society clinics extending over a 6-year period, 366 dogs of varying ages and both sexes were clinically examined for signs of glaucoma using slit-lamp biomicroscopy, indirect and direct ophthalmoscopy, tonometry, and gonioscopy.
Results The prevalence of glaucoma was 10.4% (38 dogs). Clinical signs of the disease presented from 3 years of age onwards, the commonest initial feature being the elevation of intraocular pressure (IOP) in 15 dogs (39.4%). In addition to elevated IOP, another 13 dogs (34.2%) presented with other features of glaucoma, some with lens subluxation and globe enlargement and all with possible or known vision defects. In the remaining 10 dogs (26.3%), phacodonesis or lens subluxation was observed before subsequent elevation of IOP.
Conclusions High prevalence and similarity to the primary open-angle glaucoma (POAG) seen in the Beagle and Elkhound breeds indicate that an open-angle glaucoma is present in the PBGV in the UK and that this disease may be genetically determined in this breed. Although increased IOP is the commonest early diagnostic feature, lens instability prior to an increase in IOP may be part of the clinical picture.

INTRODUCTION
An inclusive description of glaucoma in the veterinary literature is that of a pathological process usually involving elevation of intraocular pressure (IOP) and resulting in retinal ganglion cell (RGC) and optic nerve degeneration. Several etiologies are involved. In contrast to human glaucoma, where several types of the disease have been described in which the IOP remains at normal or below normal physiological levels, elevation of IOP would appear to be the major risk factor for glaucoma in all other affected animal species. Open-angle glaucoma (POAG) has been extensively described for the Beagle breed(1–3) in which it is inherited as an autosomal recessive trait.(4) Elevation of IOP between 8 and 16 months of age is described as the initial clinical feature, followed by episcleral congestion and mydriasis from approximately 24 months of age, with globe enlargement, lens subluxation, retinal degeneration, and optic disk deformation progressively developing during the following 3 years. The ophthalmoscopic features of the retinal degeneration are increased tapetal reflectivity and blood vessel attenuation, but electrophysiological studies have reported impaired RGC function prior to the appearance of these features.(5–7) The optic disk changes seen are an initial swelling followed much later by cupping with a progressive loss of myelin and closure of blood vessels.8 Significantly, the iridocorneal angle remains open until the end stages of the disease, when the ciliary cleft is collapsed. In some cases, the IOP increases gradually over several years, and although the clinical features are the same, they are slower to present and affected dogs usually remain visual throughout.(9) POAG has been similarly described for the Norwegian Elkhound, the disease being most commonly diagnosed in middle-aged and older dogs.(10–12) It is characterized by an initial small elevation in IOP and an open iridocorneal angle. The lens subluxation which occurs in some affected dogs is considered to be a secondary feature to the IOP rise.

In the Beagle, POAG has been shown to be due to a Gly661Arg missense mutation of the metalloproteinase ADAMTS 10 gene in which a glycine substitution of arginine within its cysteine-rich domain affects microfibril formation and function.(13) The effects are seen in the extracellular matrix (ECM) in both the trabecular mesh- work and the scleral lamina cribrosa, similar to POAG in man where cellular and ECM abnormalities have been described in the same structures.(14) A missense mutation in the exon 9 of the ADAMTS 10 gene is considered to be responsible for POAG in the Norwegian Elkhound, an alanine to threonine change affecting its function in ECM and microfibril composition, suggesting possible defective structure of lens zonule as well as the defects in the aqueous outflow pathway and the scleral lamina cribrosa. (15)

An isolated case of possible open-angle glaucoma in the PBGV was first suspected in 1996 in the UK, and further reports stimulated the breed society to organize an extensive survey upon which this study is based.

ANIMALS STUDIED AND METHODS
All dogs were examined under the British Veterinary Association/Kennel Club/International Sheepdog Association Eye Examination Scheme and the health directives of the Basset Griffon Vendeen Club. Owners’ informed consent was acquired for all dogs in the study and the subsequent publication of results.

Three hundred and sixty-six adult PBGV dogs aged between 8 months and 6 years were examined by the author over a 6-year period from 2009 to 2014. There were 242 females (196 entire) and 124 males (93 entire). Most dogs were seen only once, but 108 dogs including 11 receiving glaucoma treatment were re-examined on at least two occasions. All the dogs were examined in dark room facilities using slit-lamp biomicroscopy (Keeler, PSL Classic, Windsor, UK), both indirect and direct ophthalmoscopy (Keeler), applanation tonometry (Tono-Pen Vet, Medtronic, Jacksonville, FL, USA), and gonioscopy (Barkan lens, Medical Workshop, Groningen, Netherlands). Tonometry and gonioscopy using 0.5% proxymetacaine HCl (Minims, Laboratoire Chauvin, Aubenas, France) were completed before inducing mydriasis with 1% tropicamide (Mydracyl 1%, SA Alcon-Couvreur, Puurs, Belgium). Slit-lamp biomicroscopy was completed before and after mydriasis and ophthalmoscopy completed after mydriasis. Vision assessment was based on history, menace and dazzle reflexes, and, whenever possible and where indicated, maze performance.

All 28 dogs presenting with increased IOP, with or  without other signs of glaucoma, and the 10 dogs presenting with phacodonesis or lens subluxation in normotensive eyes were DNA sampled using standard buccal mucosal swabs (Animal Health Trust, Newmarket, United Kingdom) taken at the time of the initial examination. The commercially available tests for the ADAMTS 10 mutation responsible for POAG in the Beagle13 and the ADAMTS 17 mutation responsible for primary lens luxation in several breeds(16,17) were completed by the Kennel Club Genetics Centre at the Animal Health Trust (http:// www.aht.org.uk/genetics_test.html).

RESULTS
Clinical findings
In addition to the normal, five clinical presentations associated with glaucoma could be described at the primary examination, the details of which are found in Table 1 (summary of the clinical findings at the initial ophthalmic examination in 366 Petit Basset Griffon Vendeen dogs). There were 328 normotensive dogs in which the iridocorneal angles were open and the pectinate ligaments considered to be normal (group A, Table 1). All quadrants of the angle could be sufficiently examined using the combination of goniolens and biomicroscope. There was considerable variation in the amount of pigmentation in both pigment bands and although individual pectinate fibers varied in thickness, fibrae latae and laminae (sheeting) were not seen. (Fig. 1). The average normal IOP for this group was 18.2 mmHg, with a standard deviation of ±2.8 mmHg.

Twenty-eight dogs presented with elevated IOP values of between 34 and 48 mmHg (groups B to E, Table 1). The iridocorneal angles were open without pectinate ligament abnormality in 24 of these dogs (groups B to D) (Fig. 2). Other features of glaucoma were seen in groups C and D (see Table 1), and in the 4 dogs in group E, angle closure was present accompanied by globe enlargement, lens subluxation, retinal degeneration, and optic disk cupping (Fig. 3).

Table 1. Summary of the clinical findings at the initial ophthalmic examination in 366 Petit Basset Griffon Vendeen dogs

In a further 10 dogs (group F, Table 1), the initial presenting clinical features were either phacodonesis or lens subluxation seen unilaterally (three dogs) or bilaterally (six dogs) in normotensive eyes (Fig. 4). The phacodonesis was usually accompanied by iridodonesis, and where subluxation was present, the early aphakic crescent was always seen dorsally or dorsolaterally. Within the crescent, either intact elongated zonular fibers were seen or the lens equator was irregularly darkened or highly reflective. In two dogs, possible vitreal or zonular material was seen within the pupillary aperture in the region of the aphakic crescent. The iridocorneal angles were open and without pectinate ligament abnormality. Vision was considered to be normal in these 10 dogs at the initial examination:

Figure 1
Figure 1. An open iridocorneal angle in a 4-year-old normotensive PBGV, dorsolateral quadrant, right eye, showing normal pectinate fibers and pigmentation of the pigment bands. The pupil is semi-dilated.
Figure 2
Figure 2. An open iridocorneal angle in a 5-year-old PBGV with  glaucoma, dorsolateral quadrant, left eye. There is no pigmentation of the pigment bands, and the pupil is dilated.

 

 

 

 

 

 

 

 

 

Figure
Figure 3. Closure of the iridocorneal angle in a 6-year-old PBGV with glaucoma and globe enlargement. Dorsolateral quadrant, left eye.
Figure 4. The normotensive right eye of a 4-year-old PBGV exhibiting a dorsolateral aphakic crescent.

 

 

 

 

 

 

 

Subsequently, elevated IOP values were recorded in all 10 dogs and despite subsequent treatment to restore and maintain normotension, six developed defective vision.

Lens subluxation was most marked in the four dogs in  group E (Table 1), but as the lenses seemingly remained attached to the anterior vitreous in all the dogs throughout the course of the study, complete luxation with the lens either displacing posteriorly into the vitreous or anteriorly into the pupil or the anterior chamber was not seen. Patchy peripapillary or generalized retinal degeneration was seen in the 4 dogs presenting with globe enlargement at the initial presentation, two of which were clinically blind (group E, Table 1). Retinal changes were subsequently seen in nine medically treated dogs (Xalatan, Pfizer, Havant, UK) from groups B and F for which regular re-examination was possible. In another two dogs from group B in which shunt surgery maintained normotension, retinal degeneration progressively developed during an 18-month follow-up period. In these 11 dogs, tapetal hyper-reflectivity was seen initially in the peripapillary and mid-tapetal zones of the fundus, but gradually the hyper-reflectivity became more generalized and was accompanied by superficial retinal blood vessel attenuation. An initial thinning of the peripheral disk tissue was seen on ophthalmoscopy using a red-free filter in seven of these 11 dogs: It was accompanied by papillary blood vessel attenuation, but the subsequent cupping recorded in only three dogs re-examined at the end of the study was minimal and the iridocorneal angles were open at this stage.

When corneal edema was present (groups D and E, Table 1), it was mild and the degree of episcleral congestion was variable (groups C, D and E, Table 1). Marked optic disk changes were only seen in the four dogs in group E (Table 1), the disks appearing smaller than normal with cupping rendering them dark in appearance.

Twenty-five females (10.3%) and 13 males (10.4%) were affected, with no significant relationship found between gender and the disease (chisquare (2, N = 366) = 0.002, P > 0.05).

All 38 affected dogs tested negatively for both the  ADAMTS 10 and the ADAMTS 17 mutations.

Among the 366 dogs, there were several incidental findings including 58 dogs with minor persistent pupillary membrane remnants, 19 dogs with distichiasis, six dogs with corneal scarring, and two dogs with corneal lipidosis.

DISCUSSION
The glaucoma seen in the PBGV in this study is substantially similar to that previously described for POAG in both the Beagle and the Norwegian Elkhound. Iridocorneal angles were open in all but the four dogs with marked globe enlargement, and the commonest initial clinical sign of disease was the increase in IOP seen in 39.4% of affected dogs. However, phacodonesis or lens subluxation prior to a subsequent elevation of IOP was noted in 26.3% of initially normotensive dogs. These results beg the obvious question: in this breed are there two diseases with two distinct etiologies for which the common end point is glaucoma or just one disease in which both lens zonule and the aqueous drainage pathway are affected? Comparison with POAG in the Beagle is valid in an examination of the role of increased IOP as the initiating factor in the subsequent development of the pathological features of glaucoma. Undoubtedly sustained IOP elevation will cause both structural damage and functional damage, but in Beagle POAG disturbance of the IOP seemingly may be just one part of a complex of changes contributing to the overall picture, rather than the initiating cause of the glaucoma. PERG studies have shown that there can be a decrease in RGC function before a rise in IOP.(5–7) Reduction in both orthograde and retrograde axoplasmic flows, reduced blood vessel velocity at the scleral lamina cribrosa, and impairment of orbital microcirculation all similarly occur before pressure rises.(8,18–20)

The traditional view of lens subluxation in POAG in the Beagle is that it is a function of globe enlargement when the zonular fibers are stretched to the point of partial disruption, but Komaromy et al.(21) have recently reported lens luxation prior to increased IOP. Stretching and tearing of the zonular fibers were recorded as early as 6 months of age in normotensive eyes. This is an important observation for the affected dogs were homozygous for the ADAMTS 10 mutation responsible for POAG in the Beagle, suggesting that this mutation may have an effect on extracellular matrix in several parts of the eye. Elevation of IOP was the earliest indication of glaucoma in most of the affected PBGV dogs, but the presence of phacodonesis or lens subluxation prior to the subsequent elevation of IOP in normotensive eyes may reflect lens zonular abnormalities similar to those seen in the Beagle with POAG. The disease in the PBGV bears many similarities to the human Weill–Marchesani syndrome in which lens luxation is a predominant feature, together with short stature. Mutations of both the ADAMTS 10 and ADAMTS 17 genes are involved.(22) Canine primary lens luxation (PLL) has been shown to result from a different mutation in the ADAMTS metalloproteinase family, a single nucleotide substitution of intron 10 of ADAMTS  17. (16) However, the PLL classically seen in the terrier breeds is more typically associated with acute onset, secondary angle closure due to pupillary block, in sharp contrast to the chronic, gradually progressive course of the disease in the PBGV. Although none of the glaucomatous PBGV dogs tested positive for either the previously identified Beagle ADAMTS 10 or terrier ADAMTS 17 mutations, the possibility of other mutations in either of these genes, or related genes, cannot be excluded.

There were several unavoidable limitations to this study, the greatest of which were the practicalities of subsequent regular re-examination for all the dogs involved. Assessment of IOP and its normal value are essential factors in the diagnosis of open-angle glaucoma simply because the early elevations are small and initially asymptomatic. The same examiner and tonometer were employed to reduce operator error, but despite most of the examinations being conducted during the middle 5 or 6 h of the day, the readings could not take into account diurnal variation or other factors that can influence results. IOP estimations are not constant even in the same dog, and ideally, several daily recordings are preferable to single examinations. Diurnal variation may be as much as 3 or 4 mmHg. in normotensive dogs, but differences of up to 10 mmHg. have been recorded in POAG patients.(23) Tonography, ultrasonography, color Doppler technology, water provocation, and corticosteroid challenge tests were not practical in the context of this study. Tonography could have identified a reduced aqueous outflow facility in those dogs predisposed to open-angle glaucoma,(10,11) and ultrasonography may have demonstrated possible changes within the ciliary cleft which could impair aqueous outflow.(24) Electroretinography may identify retinal functional abnormalities in advance of ophthalmoscopic abnormalities in glaucoma. Subtle ophthalmoscopic signs of retinal and optic disk degeneration were observed, but the nature of this clinical study did not permit histological confirmation of the extent or nature of the underlying pathology.

The size of the PBGV population in the UK is unknown, but official Kennel Club registrations for the last 10 years total 1565 dogs. This would suggest that the 366 dogs examined in this study were representative of the breed at large and that the prevalence figure and the clinical features of a possible POAG in this breed are reliable. Inclusive of those dogs that presented with phacodonesis or lens subluxation prior to ocular hypertension, the survey records an overall glaucoma period prevalence of 10.4% for the breed.. The slow course of early disease without the dramatic features of an angle-closure glaucoma means that unless there is regular ocular examination of young to middle-aged dogs, owners may only become aware of the disease when sight impairment or globe enlargement becomes noticeable. This high prevalence of a disease clinically similar to the POAG inherited in the Beagle and Elkhound breeds strongly supports speculation that it is also genetically determined. High prevalence and late clinical diagnosis combine to complicate current breeding programs for the PBGV and will render disease control extremely difficult until a possible mode of inheritance is determined and a DNA test developed.

 

REFERENCES

  1. Gelatt KN, Peiffer RL, Gwin RM et al. Clinical manifestations of inherited glaucoma in the Beagle. Investigative Ophthalmology & Visual Science 1977; 16: 1135–1148.
  2. Peiffer RL, Gelatt KN. Aqueous humour outflow in Beagles with inherited glaucoma: gross and light microscopic observations of the iridocorneal angle. American Journal of Veterinary Research 1980; 41: 861–867.
  3. Gelatt KN, Gum GG, Gwin RM et al. Primary open angle glaucoma: inherited open angle glaucoma in the Beagle. American Journal of Pathology 1981; 102: 292–295.
  4. Gelatt KN, Gum GG. Inheritance of primary open angle glaucoma in the Beagle. American Journal of Veterinary Research 1981; 42: 1691–1693.
  5. Ofri R, Dawson WW, Gelatt KN. Visual resolution in normal and glaucomatous dogs determined by pattern electroretinogram. Veterinary & Comparative Ophthalmology 1993; 3: 111–116.
  6. Ofri R, Dawson WW, Foli K et al. Primary open angle glaucoma alters retinal recovery from a thiobarbiturate: spatial frequency dependence. Experimental Eye Research 1993; 56: 481–488.
  7. Ofri R, Samuelson DR, Strubbe DT et al. Altered retinal recovery and optic nerve fibre loss in primary open angle glaucoma in the Beagle. Experimental Eye Research 1994; 58: 245–258.
  8. Brooks DE. Confocal scanning laser ophthalmoscopy. Transactions of the American College of Veterinary Ophthalmology 1996; 27: 130.
  9. Gelatt KN, Brooks DE. The canine glaucomas. In: Veterinary Ophthalmology. (ed. Gelatt KN) Lippincott Williams and Wilkins, Baltimore, 1999; 701–754.
  10. Bjerkas E, Peiffer RL, Ekesten B. Primary glaucoma in the Norwegian Elkhound. Transactions of the American College of Veterinary Ophthalmology 1994; 25: 74.
  11. Ekesten B, Bjerkas E, Kongsengen K et al. Primary glaucoma in the Norwegian Elkhound. Veterinary & Comparative Ophthalmology 1997; 7: 14–18.
  12. Oshima Y, Bjerkas E, Peiffer RL. Ocular histopathologic observations in Norwegian Elhounds with primary open-angle, closed cleft glaucoma. Veterinary Ophthalmology 2004; 7: 185–188.
  13. Kuchtey J, Olson LM, Rinkoski T et al. Mapping of the disease locus and identification of ADAMTS 10 as a candidate gene in a canine model of primary open angle glaucoma. PLoS Genetics 2010; 7: e1001306.
  14. Gottanka J, Johnson DH, Martus P. Severity of optic nerve damage in eyes with POAG is correlated with changes in the trabecular meshwork. Journal of Glaucoma 1997; 6: 123–132.
  15. Ahonen SJ, Kaukonen M, Nussdorfer FD et al. A novel missense mutation in ADAMTS 10 in Norwegian Elkhound glaucoma. PLoS ONE 2014; 9(11): e111941.
  16. Farias FH, Johnson GS, Taylor JF et al. An ADAMTS 17 splice donor site mutation in dogs with primary lens luxation. Investigative Ophthalmology and Visual Science 2010; 51: 4716– 4721.
  17. Gould D, Pettit L, McLaughlin B et al. ADAMTS 17 mutation associated with primary lens luxation is widespread among breeds. Veterinary Ophthalmology 2011; 14: 378–384.
  18. Samuelson DA, Williams LW, Gelatt KN et al. Orthograde rapid axoplasmic transport and ultrastructural changes of the optic nerve. Part 2. Beagles with primary open angle glaucoma. Glaucoma 1993; 5: 174–184.
  19. Gelatt-Nicholson KJ, Gelatt KN, Mackay EO et al. Comparative Doppler imaging of the ophthalmic vasculature in normal Beagles and Beagles with inherited open angle glaucoma. Veterinary Ophthalmology 1999; 2: 97–105.
  20. Bito LZ. The physiology and pathophysiology of intraocular fluids. In: The Ocular and Cerebrospinal Fluids. (eds Bito LZ, Davson H, Fenstermacher JD) Academic Press: New York, 1977; 273–289.
  21. Komaromy EM, Storey ES, Iwabe S et al. New insight on an old disease: primary abnormalities in the extracellular matrix of lens zonules and sclera in Beagles with inherited open-angle glaucoma. Proceedings of the ECVO meeting, Trieste 2012; P. 43.
  22. Morales J, Al-Sharif L, Khalil DS et al. Homozygous mutations of ADAMTS 10 and ADAMTS 17 cause lenticular myopia, ectopia lentis, glaucoma, spherophakia and short stature. American Journal of Human Genetics 2009; 85: 558–568.
  23. Gelatt KN, Gum GG, Barrie KP et al. Diurnal variations in intraocular pressure in normotensive and glaucomatous Beagles. Glaucoma 1981; 3: 121–124.
  24. Samuelson DA, Gum GG, Gelatt KN. Ultrastructural changes in the aqueous outflow apparatus of Beagles with inherited glaucoma. Investigative Ophthalmology and Visual Science 1989; 30: 550–561.

© 2016 American College of Veterinary Ophthalmologists, Veterinary Ophthalmology, 20, 98–102

(PBGVCA does not provide specific medical advice, but rather provides users with information to help them better understand health and disease. Please consult with a qualified health care professional for answers to medical questions.)

Share this...